¿Qué es el sulforafano? | El Paso, TX Doctor De Quiropráctica
Dr. Alex Jimenez, Quiropráctico de El Paso
Espero que hayan disfrutado de nuestras publicaciones en varios temas relacionados con la salud, la nutrición y las lesiones. Por favor, no dude en llamarnos o llamarme si tiene preguntas cuando surja la necesidad de buscar atención. Llame a la oficina oa mí mismo. Oficina 915-850-0900 - Móvil 915-540-8444 Saludos. Dr. J

Sulforafano es un fitoquímico, una sustancia dentro del grupo isotiocianato de compuestos organosulfurados, que se encuentra en los vegetales crucíferos, como el brócoli, la col, la coliflor y las coles de Bruselas. También se puede encontrar en bok choy, col rizada, coles, hojas de mostaza y berros. Los estudios de investigación han demostrado que el sulforafano puede ayudar a prevenir varios tipos de cáncer Activando la producción de Nrf2., o factor nuclear relacionado con el factor 2 eritroide, un factor de transcripción que regula los mecanismos antioxidantes protectores que controlan la respuesta de la célula a los oxidantes. El propósito del siguiente artículo es describir la función del sulforafano.

Abstract

El sistema antioxidante KEAP1-Nrf2-ARE es un medio principal por el cual las células responden al estrés oxidativo y xenobiótico. El sulforafano (SFN), un isotiocianato electrofílico derivado de vegetales crucíferos, activa la vía KEAP1-Nrf2-ARE y se ha convertido en una molécula de interés en el tratamiento de enfermedades en las que el estrés oxidativo crónico desempeña un papel etiológico importante. Aquí demostramos que las mitocondrias de las células epiteliales pigmentadas de la retina humana (RPE-1) tratadas con SFN se someten a una hiperfusión que es independiente tanto de Nrf2 como de su inhibidor citoplasmático KEAP1. Se ha informado que la fusión mitocondrial es citoprotectora al inhibir la formación de poros en las mitocondrias durante la apoptosis, y de manera consistente, mostramos la citoprotección independiente de Nrf2 de células tratadas con SFN expuestas al inductor de apoptosis, estaurosporina. Mecánicamente, el SFN mitiga el reclutamiento y / o la retención del factor de fisión soluble Drp1 en las mitocondrias y en los peroxisomas, pero no afecta la abundancia general de Drp1. Estos datos demuestran que las propiedades beneficiosas de SFN se extienden más allá de la activación del sistema KEAP1-Nrf2-ARE y requieren una mayor interrogación dado el uso actual de este agente en múltiples ensayos clínicos.

Palabras clave: Sulforafano, Nrf2, Drp1, Mitocondrias, Fisión, Fusión, Apoptosis

Introducción

Sulforaphane es un inhibidor independiente de Nrf2 de la fisión mitocondrial

El sulforafano (SFN) es un compuesto de isotiocianato derivado de la dieta más comúnmente de los vegetales crucíferos [56]. Se genera en las plantas como una respuesta xenobiótica a la depredación a través de la liberación vesicular de la enzima hidrolítica miosinasa de las células dañadas; esta enzima convierte los glucosinolatos en isotiocyantes [42]. Durante las últimas dos décadas, el SFN se ha caracterizado ampliamente por sus propiedades anticancerígenas, antioxidantes y antimicrobianas [57]. Gran parte de esta eficacia se ha atribuido a la capacidad de SFN para modular la vía de señalización del elemento de respuesta antioxidante (ARE) KEAP1-Nrf2, aunque se han identificado actividades adicionales del compuesto, incluida la inhibición de la actividad de la histona desacetilasa y la progresión del ciclo celular [ 29]. Nrf2 es el principal factor de transcripción antioxidante y, en condiciones de homeostasis, su estabilidad se suprime a través de la acción del complejo citoplasmático de la ligasa Cullin3KEAP1 [20]. Específicamente, Nrf2 se recluta a la ligasa Cullin3KEAP1 mediante la unión al adaptador de sustrato dimérico KEAP1 y posteriormente se modifica con cadenas poliUb que apuntan al factor de transcripción para la degradación mediada por proteasoma. Esta rotación constitutiva limita la vida media de Nrf2 en celdas sin estrés a ~ 15 min [30], [33], [46], [55]. En respuesta a numerosos tipos de estrés, principalmente el estrés oxidativo, KEAP1, una proteína rica en cisteína, actúa como un sensor redox, y la modificación oxidativa de cisteínas críticas, particularmente C151, de KEAP1NUMX disocia Nrf2-KEAP1 de CUL3XXXXXXXXXXXXXNXX-KEAP2® 8], [20], [55]. En particular, SFN, y posiblemente otros activadores Nrf2, imitan el estrés oxidativo modificando C151 de KEAP1, por ejemplo, [21]. La estabilización de Nrf2 permite su translocación al núcleo donde induce la expresión de una batería de genes de desintoxicación y antioxidantes de fase II. Nrf2 se une a los elementos promotores de la respuesta antioxidante (ARE) de sus genes diana relacionados mediante la heterodimerización con pequeñas proteínas Maf [19]. Este sistema presenta una respuesta dinámica y sensible a los antioxidantes indirectos como SFN, los radicales libres generados por las mitocondrias [16] u otras fuentes fisiológicas de estrés oxidativo [41].

Las mitocondrias son orgánulos subcelulares dinámicos que regulan una gran cantidad de funciones celulares que van desde la producción de ATP y el amortiguamiento de calcio intracelular hasta la regulación redox y la apoptosis [13], [49]. Las mitocondrias también representan la principal fuente de especies reactivas de oxígeno (ROS) dentro de la célula. Por lo tanto, es necesaria una regulación adecuada de la función mitocondrial para optimizar la producción de ATP para satisfacer las necesidades celulares al tiempo que minimiza los efectos potencialmente dañinos de la producción excesiva de radicales libres. Un requisito crítico para la modulación fina de la función mitocondrial es la capacidad de las mitocondrias para funcionar de manera independiente como máquinas bioquímicas y como parte de una red amplia y receptiva.

La morfología y la función de la red mitocondrial están determinadas por un equilibrio regulado entre la fisión y la fusión. La fisión mitocondrial es necesaria para la herencia de las mitocondrias de células hijas durante la división celular [28], así como para la degradación autofágica y selectiva de las mitocondrias despolarizadas o dañadas, denominada mitofagia [1]. A la inversa, se requiere la fusión para complementar los genomas mitocondriales y compartir componentes de la cadena de transporte de electrones entre las mitocondrias vecinas [54]. A nivel molecular, la fisión mitocondrial y la fusión están reguladas por grandes GTPasas similares a dinaminas. Tres enzimas regulan principalmente la fusión: las mitofusinas 1 y 2 (Mfn1 / 2) son proteínas de membrana externa de dos pases que median la fusión de la membrana externa mediante interacciones heterotípicas entre mitocondrias adyacentes [15], [25], [37], mientras que OPA1 es un interior Proteína de membrana que asegura simultáneamente la conectividad de la matriz regulando la fusión de las membranas internas [5]. La actividad GTPasa de las tres proteínas se requiere para una fusión robusta [5], [18], y OPA1 está más regulada por la proteólisis compleja dentro de la membrana interna mitocondrial por las proteasas OMA1 [14], PARL [6], y YME1L [45] ]. Es importante destacar que se requiere un potencial de membrana mitocondrial intacto para una fusión eficiente con el fin de suprimir la integración de las mitocondrias dañadas y sanas [26].

La fisión mitocondrial es principalmente catalizada por una proteína citosólica llamada proteína relacionada con Dynamin 1 (Drp1 / DNM1L). Drp1 se contrata desde el citosol hasta sitios prospectivos de fisión en la membrana externa mitocondrial [43]. Los principales receptores para Drp1 en la membrana externa son el factor de fisión mitocondrial (Mff) [32] y, en menor medida, la Fisión 1 (Fis1) [51]. Además, se descubrió un receptor señuelo, MIEF1 / MiD51, que actúa para limitar aún más la actividad de la proteína Drp1 en los posibles sitios de fisión [58]. Una vez acoplado a la membrana externa mitocondrial, Drp1 se oligomeriza en estructuras en forma de espiral alrededor del cuerpo de la mitocondria y luego utiliza la energía derivada de la hidrólisis de GTP para mediar la escisión física de las membranas internas y externas mitocondriales [17]. Los túbulos derivados del retículo endoplásmico actúan como un constrictor inicial de las mitocondrias antes de la oligomerización Drp1, lo que subraya la revelación de que las mitocondrias no constrictas son más anchas que la circunferencia permisiva de una espiral Drp1 completa [12]. La dinámica de la actina también es importante para las interacciones ER-mitocondrias que preceden a la fisión mitocondrial [24]. Además de su papel en la fisión mitocondrial, Drp1 cataliza la fisión de los peroxisomas [40].

Drp1 es muy similar a la proteína dinamina bien caracterizada porque ambas proteínas contienen un dominio GTPasa N-terminal, un dominio Medio que es crítico para la autooligomerización, y un dominio efector de GTPasa C-terminal [31]. Drp1 logra una selectividad para las membranas mitocondriales a través de una combinación de interacciones con sus proteínas receptoras Mff y Fis1 y también a través de su afinidad por la cardiolipina fosfolípida específica de mitocondrias a través del dominio único de inserción B de Drp1 [2]. Drp1 generalmente existe como un homotetramer en el citoplasma, y ​​el ensamblaje de orden superior en los sitios de fisión mitocondrial está mediado por el dominio Medio de Drp1 [3].

Dado el vínculo implícito entre la función mitocondrial y la ruta KEAP1-Nrf2-ARE, investigamos los efectos de la activación de Nrf2 en la estructura y función mitocondrial. Aquí demostramos que SFN induce hiperfusión mitocondrial que, inesperadamente, es independiente tanto de Nrf2 como de KEAP1. Este efecto de SFN es a través de una inhibición de la función Drp1. También demostramos que SFN confiere resistencia a la apoptosis que es independiente de Nrf2 e imita a la observada en células agotadas de Drp1. Estos datos indican colectivamente que, además de estabilizar y activar Nrf2, SFN modula la dinámica mitocondrial y preserva la capacidad y la supervivencia celular.

Resultados

Sulforaphane Induce Hiperfusión Independiente De Nrf2 / KEAP1 De Mitocondria

En el curso del estudio de los efectos de la activación de Nrf2 en la dinámica de la red mitocondrial, descubrimos que el tratamiento de células epiteliales del pigmento retinal humano inmortalizadas (RPE-1) con sulforafano (SFN), un potente activador de la señalización de Nrf2, indujo una fusión robusta de La red mitocondrial en comparación con las células de control tratadas con vehículo (Fig. 1A y B). La morfología de las mitocondrias en estas células se parecía mucho a la de las mitocondrias en las células agotadas por ARNsi de Drp1 endógeno, el principal factor de fisión mitocondrial (Fig. 1A). Este resultado planteó la intrigante idea de que la fisión mitocondrial y el estado de fusión responden directamente a los niveles de Nrf2 en la célula. Sin embargo, la estimulación de células con otros estabilizadores y activadores de Nrf2, como el inhibidor del proteasoma MG132, el pro-oxidante tBHQ, o la desactivación del inhibidor de Nrf2 KEAP1 no indujo fusión mitocondrial (Fig. 1A y B). La estabilización de Nrf2 mediante estas manipulaciones se confirmó mediante transferencia de Western para Nrf2 endógeno (Fig. 1C). Además, la expresión de Nrf2 era prescindible para la fusión mitocondrial inducida por SFN, ya que la eliminación de Nrf2 endógeno con siRNA no pudo contrarrestar este fenotipo (Fig. 1D-F). Debido a que SFN estimula la vía KEAP1-Nrf2-ARE modificando de manera covalente los residuos de cisteína de KEAP1 [21], eliminamos KEAP1 para determinar si la hiperfusión mitocondrial inducida por SFN es de carácter independiente, pero no está obsesionada con el contenido, no está obsesionada con la presencia de NN. Sin embargo, el agotamiento de KEAP1 tampoco logró anular la fusión mitocondrial inducida por SFN (Fig. 2G-I). De hecho, SFN invirtió la morfología de pro-fisión inducida por el agotamiento de KEAP1 (Fig. 1G, panel b versus panel d). Estos resultados indican que el tratamiento con SFN causa una fusión mitocondrial independiente de la vía canónica KEAP1-Nrf1-ARE y nos llevó a interrogar si la SFN afecta directamente a los componentes de la maquinaria de fusión o fisión mitocondrial.

La figura 1 SFN induce la fusión mitocondrial independiente de Nrf2 / KEAP1. (A) Las células RPE-1 se transfectaron con los siRNA indicados y 3 días más tarde tratados con DMSO o los activadores Nrf2 SFN (50 μM), MG132 (10 μM) o tBHQ (100 μM) para 4 h. Las mitocondrias (rojas) están marcadas con un anticuerpo anti-Tom20, y los núcleos (azules) se contrastan con DAPI. (B) Gráfico que muestra la cuantificación de la puntuación de morfología mitocondrial de (A). > Las células 50 por condición se evaluaron de forma ciega. (C) Western blots representativos de (A). (D) Las células RPE-1 se transfectaron con siRNA 10 nM y 3 días más tarde se trataron con SFN para 4 h antes de fijarse y teñirse como en (A). (E) Gráfico que muestra la cuantificación de la puntuación del fenotipo mitocondrial de (D). > Las células 100 por condición se evaluaron de forma ciega. (F) Western blots representativos de (D). (G) Las células se transfectaron y se trataron como en (D) con siCON o siKEAP1. (H) Las células de (G) se calificaron como en (B) y (E) sobre la base de la morfología mitocondrial. (I) Western blots representativos de (G). Los datos en (B), (E) y (H) se compilaron a partir de experimentos independientes de 3 cada uno y la significación estadística se determinó mediante la prueba t de Student de dos colas. Las barras de error reflejan +/- SD (Para la interpretación de las referencias al color en esta leyenda de la figura, el lector se refiere a la versión web de este artículo)

Sulforaphane daña la asociación mitocondrial de Drp1

En base al hallazgo de que el tratamiento con SFN induce hiperfusión mitocondrial, razonamos que este fenotipo era una consecuencia de una actividad de fusión excesiva o una inhibición de la actividad de fisión. Para discriminar entre estas dos posibilidades, comparamos la morfología de los peroxisomas en presencia y ausencia de SFN. Los peroxisomas son similares a las mitocondrias, ya que son orgánulos dinámicos cuya forma y longitud están constantemente en flujo [44]. Los peroxisomas contienen tanto Fis1 como Mff en su membrana externa y, como consecuencia, son objetivos para la fisión mediada por Drp1 [22], [23]. Sin embargo, los peroxisomas no utilizan la maquinaria de fusión de la red mitocondrial y, en consecuencia, no se someten a fusión [39]. Más bien, la fisión peroxisomal se opone al alargamiento de los peroxisomas existentes mediante la adición de novo de membranas y proteínas [44]. Debido a que los peroxisomas carecen de Mfn1 / 2 y OPA1, razonamos que si SFN activa la maquinaria de fusión en lugar de inhibir la maquinaria de fisión, la longitud del peroxisoma no se vería afectada. En las células tratadas con vehículo, los peroxisomas se mantienen como orgánulos puntiformes cortos y redondos (Fig. 2, paneles byd). Sin embargo, el tratamiento con SFN aumentó la longitud del peroxisoma en ~ 2-fold en comparación con las células de control (Fig. 2, paneles f y h). Además, muchos de los peroxisomas se pellizcaron cerca del centro, lo que indica un posible defecto de escisión (Fig. 2, panel h, puntas de flecha). Del mismo modo, los peroxisomas en las células transfectadas con Drp1 siRNA fueron anormalmente largos (Fig. 2, paneles j y l), lo que confirma que Drp1 es necesario para la fisión peroxisomal y sugiere que el tratamiento con SFN causa fenotipos mitocondriales y peroxisómicos al interrumpir la maquinaria de la fisión.

La figura 2 SFN induce alargamiento peroxisomal. (A) Las células RPE-1 se transfectaron con 10 nM del ARNsi indicado y 3 días más tarde se trataron con DMSO o 50 μM SFN para 4 h. Los peroxisomas (verdes) se marcaron con un anticuerpo anti-PMP70, las mitocondrias con MitoTracker (rojo), y el ADN se tiñe de forma alternativa con DAPI. Las inserciones ampliadas de peroxisomas se muestran a la derecha (paneles d, h, yl) para facilitar la visualización de los cambios en la morfología inducidos por el agotamiento de SFN y Drp1. Las puntas de flecha resaltan los puntos de constricción. (Para la interpretación de las referencias al color en esta leyenda de la figura, se remite al lector a la versión web de este artículo).

A continuación, determinamos cómo SFN restringe la función Drp1. Las posibilidades incluían reducciones en los niveles de expresión, reclutamiento / retención en las mitocondrias, oligomerización o actividad enzimática de la GTPasa. Un déficit en cualquiera de estos podría resultar en una reducción de la fisión mitocondrial y la hiperfusión. No detectamos cambios reproducibles en los niveles de proteína Drp1 después del tratamiento con SFN (Figs. 1C y 3A), y, por lo tanto, llegó a la conclusión de que SFN no altera la estabilidad o expresión de Drp1, lo que concuerda con que Drp1 tiene una vida media de> 10 h [50] y que nuestros tratamientos con SFN tienen una duración más corta. A continuación, investigamos si SFN afectaba el reclutamiento o la retención de Drp1 en las mitocondrias. Los estudios de fraccionamiento mostraron que SFN indujo una pérdida de Drp1 de la fracción mitocondrial (Fig. 3A, carriles 7 – 8 y Fig. 3B). Como se informó anteriormente [43], solo una pequeña fracción de Drp1 (~ 3%) está asociada con la red mitocondrial en un momento dado durante estado estable condiciones con la mayor parte de la enzima que reside en el citoplasma (Fig. 3A, carriles 5 – 8). Estos datos de fraccionamiento se confirmaron mediante un análisis de co-localización que mostró una reducción del ~ 40% en los focos de Drp1 punteados localizados por mitocondrias después del tratamiento con SFN (Fig. 3C y D). En conjunto, estos datos indican que la fusión mitocondrial inducida por SFN se debe, al menos parcialmente, a la asociación atenuada de Drp1 con las mitocondrias. Nuestros datos no distinguen si SFN interfiere con el reclutamiento mitocondrial versus la retención mitocondrial de Drp1, o ambos, ya que el análisis de Drp1 endógeno no fue capaz de visualizar la GTPasa mediante microscopía de células vivas.

La figura 3 SFN provoca una pérdida de Drp1 de las mitocondrias. (A) Fraccionamiento subcelular de células RPE-1 después de 4 h de DMSO o SFN. Los lisados ​​de células completas (WCL), las fracciones nuclear (Nuc), citosólica (Cyto) y mitocondrial en bruto (Mito) se resolvieron mediante SDS-PAGE y se procesaron para la transferencia de Western con los anticuerpos indicados. La migración de marcadores de peso molecular se indica a la izquierda. (B) Gráficos que muestran la cuantificación densitométrica de Drp1 en las fracciones indicadas de (A). (C) Las células RPE-1 se transfectaron con 10 nM siCON o siDrp1 y 3 días más tarde se trataron con DMSO o SFN para 4 h. Drp1 (verde) se visualizó con un anticuerpo anti-Drp1, mitocondrias con MitoTracker (rojo) y núcleos con DAPI (azul). (D) Análisis automatizado de co-localización de la señal de Drp1 y MitoTracker de (C). Los datos en (B) y (D) se compilaron de los experimentos independientes de 3 y 5, respectivamente, y la significación estadística se determinó mediante la prueba t de Student de dos colas. Las barras de error reflejan +/- SD y los asteriscos denotan significación estadística. (Para la interpretación de las referencias al color en esta leyenda de la figura, se remite al lector a la versión web de este artículo).

Sulforaphane confiere protección contra la apoptosis inducida por estaurosportina independiente de Nrf2

Trabajos anteriores han demostrado que la fisión mitocondrial es permisiva en la formación de poros en la membrana mitocondrial externa generada por Bax / Bak durante la apoptosis [11]. Se ha demostrado que Drp1 se ha reclutado selectivamente para mitocondrias durante la apoptosis [11] y, en concordancia con esto, se han observado mitocondrias fragmentadas al principio del proceso [27]. A la inversa, se cree que la inhibición de la fisión mitocondrial inhibe la apoptosis al bloquear la formación de los poros de la membrana externa que permiten la liberación del citocromo c [53]. En consecuencia, la estimulación de la fusión mitocondrial retrasa la progresión de la apoptosis inducida por compuestos que incluyen estaurosporina (STS) [14]. Para determinar si SFN protege a las células RPE-1 de la apoptosis mediada por STS y, en caso afirmativo, si esto requiere Nrf2, establecimos un ensayo para inducir fácilmente la escisión de poli ADP ribosa polimerasa (PARP), un sustrato de caspasa activada-3 y definitivo marcador de apoptosis. El tratamiento de las células RPE-1 con 1 µM ​​STS para 6 h solo causó una escisión muy moderada de la PARP, pero esto se evitó mediante el co-tratamiento de SFN (por ejemplo, Fig. 4A, carril 3 versus 4). Para aumentar la robustez de este ensayo, sensibilizamos aún más las células a la apoptosis inducida por STS mediante un tratamiento previo con ARNsi que se dirige al factor anti-apoptótico, Bcl-XL. Este tratamiento previo redujo la expresión de Bcl-XL y promovió marcadamente la división de PARP en función del tiempo expuesto a STS (Fig. 4B, compare el carril 2 con los carriles 4 – 10). Es importante destacar que 2 h de tratamiento previo con SFN mitigó la escisión de PARP en células expuestas a STS (Fig. 4C, carril 3 versus 4 y carril 5 versus 6). Del mismo modo, las células agotadas de Nrf2 por CRISPR / Cas9 se protegieron de manera comparable de la toxicidad por STS mediante pretratamiento con SFN (Fig. 4C, carril 11 versus 12 y carril 13 versus 14 y Fig. 4D). Esta protección se observó utilizando tanto la división PARP (Fig. 4C y D) como la morfología celular (Fig. 4E) como lecturas. La eficacia del agotamiento de Nrf2 por CRISPR / Cas9 se confirmó mediante transferencia Western (Fig. 4C, transferencia Nrf2). Como se predijo, el agotamiento de las células de Drp1, que también produce un fenotipo de hiperfusión (Fig. 1A), también bloqueó la escisión de PARP en respuesta a STS en comparación con las células de control incubadas con SFN (Fig. 4F y G). En conjunto, estos hallazgos son consistentes con la protección de la SFN contra la apoptosis a través de su capacidad para restringir la función Drp1, independientemente de la estabilización y activación de Nrf2.

Figura 4 Los efectos citoprotectores de SFN son independientes de la expresión de Nrf2 (A) Las células RPE-1 se trataron previamente con DMSO o 50 μM SFN para 2 h antes del tratamiento con DMSO, 1 μM staurosporine (STS), o 50 μM etoposide 6 h y se procesaron para transferencia Western anti-PARP. (B) Las células RPE-1 se transfectaron con 2.5 nM siCON, 1 nM siBcl-XL o 2.5 nM siBcl-XL y 3 días después se trataron con DMSO o 1 μM STS para 2, 4 o 6 h. Se muestran transferencias de Western representativas y la migración de marcadores de peso molecular se indica a la izquierda. (C) Las células RPE-9 de tipo salvaje generadas por CRISPR / Cas2 (Nrf2WT) y Nrf2 (Nrf1KO) se transfectaron con 1 nM siBcl-XL y 3 días con tratamiento previo con DMSO o con un solo cargador. Posteriormente, las células se trataron con 50 μM STS para 2, 1 o 2 h. Se muestran transferencias Western representativas con los anticuerpos indicados. (D) Cuantificación de la PARP escindida como un porcentaje de la PARP total (escindida + no escindida) de experimentos independientes de 4. Es importante destacar que los niveles de PARP escindidos fueron comparables tanto si las células expresaron Nrf6 como si no, lo que indica que la protección de SFN contra STS es independiente del factor de transcripción. (E) Imágenes de contraste de fase 3X tomadas inmediatamente antes de la recolección de lisados ​​de (C). Barra de escala = 2 µm. (F) Western blots representativos que demuestran que el agotamiento de Drp20 confiere una protección casi comparable de STS como tratamiento SFN. Las células RPE-65 se transfectaron con 1 nM siBcl-XL y, además, se transfectaron con 1 nM siCON o 1 nM siDrp10. Días después de 10, las células siCON se trataron previamente con SFN como en (A) y (C) y luego se expusieron a STS para 1 h antes de ser recolectadas y procesadas para transferencia de Western con los anticuerpos indicados. (G) Igual que (D) para los datos presentados en (F) compilados a partir de experimentos independientes de 3. Las barras de error reflejan +/- SEM

Discusión

Hemos descubierto que SFN modula la dinámica de fusión / fisión mitocondrial independientemente de sus efectos en la ruta KEAP1-Nrf2-ARE. Esto es intrigante debido a un vínculo asumido entre la disfunción mitocondrial y la producción de ROS y la necesidad de sofocar los radicales libres derivados de la mitocondria a través de la activación de Nrf2. Este impacto funcional adicional de SFN es de importancia potencial dado que hay más de 30 ensayos clínicos actualmente en curso que prueban SFN para el tratamiento de una variedad de enfermedades que incluyen cáncer de próstata, enfermedad pulmonar obstructiva y enfermedad de células falciformes [7], [10], [ 47].

Debido a que SFN es un isotiocianato [56] y activa la señalización de Nrf2 al acilar directamente las cisteínas críticas de KEAP1 para suprimir la degradación de Nrf2 [21], se deduce que SFN ejerce sus efectos pro-fusión modulando la actividad de una fisión o un factor de fusión a través de una modificación de cisteína. . Nuestros datos respaldan firmemente que Drp1 sea regulado negativamente por SFN, aunque aún no se ha determinado si la GTPasa es un objetivo directo de la acilación. A pesar de esta brecha de conocimiento, la función de Drp1 está siendo claramente comprometida por SFN a medida que tanto las mitocondrias como los peroxisomas se vuelven hiperfundido en respuesta al tratamiento con SFN y estos orgánulos comparten Drp1 por sus respectivos eventos de escisión [38]. Además, SFN disminuye la cantidad de Drp1 que se localiza y acumula en las mitocondrias (Fig. 3). Debido a que nuestros experimentos se realizaron con todas las proteínas endógenas, nuestra detección de Drp1 en los sitios de fisión mitocondrial se encuentra en condiciones de estado estacionario y, por lo tanto, no podemos distinguir entre un reclutamiento y un defecto de retención de la enzima causada por el SFN. Además, no podemos eliminar la posibilidad de que SFN acila un receptor en las mitocondrias (Fis1 o Mff) para bloquear el reclutamiento de Drp1. Sin embargo, sospechamos que Drp1 está directamente modificado. Drp1 tiene nueve cisteínas, ocho de las cuales residen en el dominio medio que se requieren para la oligomerización [3], y una de ellas reside en el dominio de efector de GTPasa (GED) en el extremo C de Drp1. La acilación directa de cualquiera de estas cisteínas podría causar un defecto de actividad en Drp1 y, por lo tanto, subyace al efecto de SFN en la dinámica mitocondrial. En particular, trabajos anteriores sugieren que los defectos en la oligomerización y la actividad catalítica pueden abrogar la retención de Drp1 en las mitocondrias [52]. Cys644 en el dominio GED es un objetivo particularmente atractivo basado en un trabajo previo que muestra la mutación de esta fenocopia de cisteína mutaciones que afectan la actividad de la GTPasa de Drp1 [4] y que esta cisteína en particular está modificada por electrofilos reactivos al tiol [9]. La resolución de esta pregunta pendiente requerirá una validación espectrométrica de masas..En En resumen, hemos identificado una nueva función citoprotectora para el SFN compuesto clínicamente relevante. Además de activar el factor de transcripción antioxidante maestro Nrf2, SFN promueve la fusión mitocondrial y peroxisomal, y este efecto es independiente de Nrf2. El mecanismo subyacente a este fenómeno implica una reducción en la función de la GTPasa Drp1, el mediador primario de la fisión mitocondrial y peroxisomal. Una de las principales consecuencias de la fusión mitocondrial mediada por SFN es que las células se vuelven resistentes a los efectos tóxicos de la apurosis inductor de la apuroosis. Esta acción citoprotectora adicional de SFN podría ser de particular utilidad clínica en las numerosas enfermedades neurodegenerativas para las cuales la edad es el principal factor de riesgo (p. Ej., Enfermedad de Parkinson, enfermedad de Alzheimer, degeneración macular relacionada con la edad) ya que estas enfermedades se han asociado con apoptosis y se han reducido. niveles y / o desregulación de Nrf2 [35], [36], [48]. Juntos, estos datos demuestran que las propiedades citoprotectoras de SFN se extienden más allá de la activación del sistema KEAP1-Nrf2-ARE y garantizan estudios adicionales dado el uso actual de este agente en múltiples ensayos clínicos.

Materiales y methods

Ensayos de apoptosis

Las células se sembraron y se transfectaron con ARNip como se indica a continuación. Las células se trataron previamente con 50 μM sulforaphane para 2 h para inducir la fusión mitocondrial y luego se trataron con 1 μM staurosporine para inducir la apoptosis. En el momento de la recolección, se recogieron los medios en tubos individuales y se sometieron a centrifugación a alta velocidad para sedimentar las células apoptóticas. Este sedimento celular se combinó con células adherentes y se solubilizó en tampón de Laemmli concentrado 2. Las muestras se sometieron a transferencia Western anti-PARP.

Generación de construcciones CRISPR / Cas9

Para crear LentiCRISPR / eCas9 1.1, LentiCRISPR v2 (addgene #52961) primero se cortó con Age1 y BamH1. A continuación, se amplificó la PCR con los voladizos de la fuente de luz de la mano de la máquina de la mano y de la mano de la mano de la máquina de la mano, y también de la mano de la mano. Las secuencias de sgRNA se determinaron utilizando Benchling.com. Los parámetros se establecieron para apuntar a la secuencia de codificación con las puntuaciones más altas dentro del objetivo y más bajas fuera del objetivo. Las siguientes secuencias (secuencia de dirección subrayado, HS sgNFE9L9 # 1.1 sentido CACCGCGACGGAAAGAGTATGAGC, antisentido AAACGCTCATACTCTTTCCGTCGC; hs sgNFE71814L1 # 1 CACCGGTTTCTGACTGGATGTGCT sentido, AAACAGCACATCCAGTCAGAAACC antisentido; hs sgNFE2L2 # 1 sentido CACCGGAGTAGTTGGCAGATCCAC, antisentido AAACGTGGATCTGCCAACTACTCC) se reasociaron y se ligaron en BsmB2 cortó LentiCRISPR / eCas2 2. Se seleccionaron células RPE-2 infectadas con lentitis con puromicina y se mantuvieron como una población agrupada. El golpe de gracia se confirmó mediante inmunofluorescencia y transferencia de Western.

Cultivo Celular y Transfecciones

Se cultivaron células epiteliales de pigmento de la retina humana transformadas con telomerasa (RPE-1) (ATCC) en Medio Águila Modificada de Dulbecco (DMEM) que contiene 1 g / L de glucosa suplementada con penicilina, estreptomicina, cóctel de aminoácidos no esencial de 1X (Life Technologies), y 10% de suero bovino fetal (Life Technologies). Para las transfecciones de ARNip, se sembraron células 30,000-35,000 / ml durante la noche. Las células recibieron ARNsi nNMX nM diluido en DMEM sin suero y se combinaron con reactivo de transfección con interferón 10 (PolyPlus). Para la sensibilización a la apoptosis, las células recibieron ARNsi 0.3 nM Bcl-XL. Las células se recogieron 1-2 días después de la transfección.

Productos químicos, anticuerpos y oligos siRNA

Anticuerpos contra α-tubulina (Señalización celular), β-tubulina (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Señalización celular), PMP70 (Abcam) y Tom20 (BD Biosciences) ) se utilizaron en 1: diluciones de 1000 para transferencia de Western y para inmunofluorescencia. El anticuerpo de conejo anti-Nrf2 interno se usó en 1: 2000 para la transferencia Western [34], [59]. Se usaron sulforafano (Sigma) y estaurosporina (Tocris) a 50 μM y 1 μM respectivamente. los ARNsi contra Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Señalización celular) y Bcl-XL (Señalización celular) se usaron en 10 nM a menos que se indique lo contrario.

Inmunofluorescencia y etiquetado in vivo.

Las células sembradas en cubreobjetos de vidrio 18 mm se trataron con vehículo o fármaco, se fijaron en 3.7% de formaldehído y luego se permeabilizaron en 0.2% Triton X-100 / PBS en hielo durante 10 mín. Los anticuerpos primarios se incubaron en 3% de albúmina de suero bovino (BSA) en PBS durante la noche a 4 ° C. Después de los lavados con PBS, las células se incubaron para 1 h en especies adecuadas, Alexa488 o Alexa546, anticuerpos secundarios conjugados (1 diluido: 1000) y 0.1 μg / mL DAPI (Sigma) en 3% BSA / PBS. Las mitocondrias se visualizaron mediante inmunofluorescencia anti-Tom20 o incubando células en MitoTracker Red CMXRos 200 nM (Molecular Probes, Inc.) en DMEM sin suero para 30 mín. A 37 ° C antes de la fijación.

Microscopía y Análisis de Imagen.

Las muestras de inmunofluorescencia se vieron en un microscopio confocal LSM710 (Carl Zeiss). Las micrografías se capturaron utilizando objetivos de inmersión en aceite 63X o 100X e imágenes ajustadas y mejoradas utilizando Adobe Photoshop CS6. El análisis de co-localización se realizó utilizando la función de co-localización de Carl Zeiss LSM710 con umbrales establecidos manualmente mientras se desconoce la identidad de las muestras. Las barras de escala en todo, a menos que se indique lo contrario, son 10 µm. La morfología mitocondrial se evaluó mediante puntuación ciega. Si las mitocondrias de una célula se mantenían como múltiples puntos redondos, discriminados, la célula se calificaba como "fisión". Si las mitocondrias individuales eran indistinguibles y toda la red mitocondrial aparecía continua, la célula se calificaba como "fusión". Todas las demás células, incluidas aquellas con mitocondrias agrupadas, se calificaron como "intermedias".

Fraccionamientos subcelulares

Las células RPE-1 se hicieron crecer hasta la confluencia. Después de un lavado con PBS, las células se sometieron a centrifugación a 600 xg durante 10 min y se resuspendieron en tampón de aislamiento 600 μL (manitol mN XXUMX, sacarosa mM 210, MPMS mM 70, pHNUMX mM EDTA pH 5 + 1 mM PMSF). La suspensión se lisó 7.4 veces en un homogeneizador Dounce. Una fracción del homogeneizado se conservó como un "lisado celular completo". El resto se sometió a centrifugación a 1 × g durante 30 min para sedimentar los núcleos. Los sobrenadantes se sometieron a centrifugación a 800 × g durante 10 min para eliminar los núcleos restantes y las células sin elir. Este sobrenadante se sometió a centrifugación a 1500 xg durante 10 min para sedimentar las mitocondrias. El sobrenadante se conservó como la "fracción citosólica". El sedimento se lavó suavemente con PBS y se resuspendió en tampón de aislamiento. La concentración de proteína de cada fracción se midió mediante un ensayo de ácido bicinconínico (BCA) y las cantidades equivalentes de proteína se resolvieron mediante SDS-PAGE.

Western Blot

Las células se lavaron en PBS y se solubilizaron en 2 veces el tampón de solubilización Laemmli concentrado (100 mM Tris [pH 6.8], 2% SDS, 0.008% bromofenol azul, 2% 2-mercaptoetanol, 26.3% glicerol y 0.001 Pirinina Y). Los lisados ​​se hirvieron durante 5 min antes de cargarlos en geles de poliacrilamida con dodecil sulfato de sodio (SDS). Las proteínas se transfirieron a membranas de nitrocelulosa y las membranas se bloquearon por 1 h en 5% Leche / TBST. Los anticuerpos primarios se diluyeron en 5% de leche / TBST y se incubaron con la transferencia durante la noche a 4 ° C. Los anticuerpos secundarios conjugados con peroxidasa de rábano picante (HRP) se diluyeron en 5% Leche / TBST. Las transferencias se procesaron con quimioluminiscencia mejorada y las cuantificaciones densitométricas se realizaron con el software ImageJ.

Dr Jimenez White Coat

El sulforafano es un producto químico de la colección de isotiocianatos de sustancias organosulfuradas obtenidas de vegetales crucíferos, como el brócoli, el repollo, la coliflor, la col rizada y las coles, entre otros. El sulforafano se produce cuando la enzima mirosinasa transforma la glucorafanina, un glucosinolato, en sulforafano, también conocido como sulforafano-glucosinolato. Los brotes de brócoli y la coliflor tienen la mayor concentración de glucorafanina o el precursor de sulforafano. Los estudios de investigación han demostrado que el sulforafano mejora las capacidades antioxidantes del cuerpo humano para prevenir diversos problemas de salud.

Dr. Alex Jimenez DC, CCST Insight

Sulforaphane y sus efectos sobre el cáncer, la mortalidad, el envejecimiento, el cerebro y el comportamiento, las enfermedades del corazón y más

Los isotiocianatos son algunos de los compuestos vegetales más importantes que puede obtener en su dieta. En esto Video Les hago el caso más completo que jamás se haya hecho. ¿Periodo de atención corto? Salta a tu tema favorito haciendo clic en uno de los puntos de tiempo a continuación. Completo línea de tiempo a continuación.

Secciones clave:

  • 00: 01: 14 - Cáncer y mortalidad
  • 00: 19: 04 - Envejecimiento
  • 00: 26: 30 - Cerebro y comportamiento
  • 00: 38: 06 - Resumen final
  • 00: 40: 27 - Dosis

Línea de tiempo completa:

  • 00: 00: 34 - Introducción de sulforafano, un enfoque importante del video.
  • 00: 01: 14 - Consumo de vegetales crucíferos y reducciones en la mortalidad por todas las causas.
  • 00: 02: 12 - Riesgo de cáncer de próstata.
  • 00: 02: 23 - Riesgo de cáncer de vejiga.
  • 00: 02: 34 - El cáncer de pulmón en riesgo de los fumadores.
  • 00: 02: 48 - Riesgo de cáncer de mama.
  • 00: 03: 13 - Hipotético: ¿qué sucede si ya tiene cáncer? (intervencionista)
  • 00: 03: 35 - Conducción de mecanismo plausible el cancer y datos asociativos de mortalidad.
  • 00: 04: 38 - Sulforafano y cáncer.
  • 00: 05: 32 - Muestra de evidencia en animales fuerte Efecto del extracto de brote brócoli en el desarrollo de tumores de vejiga en ratas.
  • 00: 06: 06 - Efecto de la suplementación directa de sulforafano en pacientes con cáncer de próstata.
  • 00: 07: 09 - Bioacumulación de metabolitos de isotiocianato en el tejido mamario real.
  • 00: 08: 32 - Inhibición de las células madre del cáncer de mama.
  • 00: 08: 53 - Lección de historia: Brassicas se establecieron con propiedades de salud incluso en la antigua Roma.
  • 00: 09: 16 - La capacidad de sulforafano para mejorar la excreción de carcinógenos (benceno, acroleína).
  • 00: 09: 51 - NRF2 como un interruptor genético a través de elementos de respuesta antioxidante.
  • 00: 10: 10: cómo la activación de NRF2 mejora la excreción de carcinógenos a través de los conjugados de glutatión-S.
  • 00: 10: 34 - Las coles de Bruselas aumentan la glutatión-S-transferasa y reducen el daño al ADN.
  • 00: 11: 20 - La bebida de brotes de brócoli aumenta la excreción de benceno en un 61%.
  • 00: 13: 31 - El homogeneizado de brotes de brócoli aumenta las enzimas antioxidantes en las vías respiratorias superiores.
  • 00: 15: 45 - Consumo de vegetales crucíferos y mortalidad por enfermedades del corazón.
  • 00: 16: 55 - El brote en polvo de brócoli mejora los lípidos en la sangre y el riesgo general de enfermedad cardíaca en los diabéticos tipo 2.
  • 00: 19: 04 - Comienzo de envejecimiento .
  • 00: 19: 21 - Mejoras en la dieta enriquecida con sulforafano esperanza de vida de escarabajos de 15 a 30% (en ciertas condiciones).
  • 00: 20: 34 - Importancia de la inflamación baja para la longevidad.
  • 00: 22: 05 - Las verduras crucíferas y el brote de brócoli en polvo parecen reducir una amplia variedad de marcadores inflamatorios en los humanos.
  • 00: 23: 40 - Resumen del medio video: cáncer, envejecimiento, secciones
  • 00: 24: 14: los estudios con ratones sugieren que el sulforafano podría mejorar la función inmunológica adaptativa en la vejez.
  • 00: 25: 18 - Sulforaphane mejoró el crecimiento del cabello en un modelo de ratón de calvicie. Imagen en 00: 26: 10.
  • 00: 26: 30 - Inicio del cerebro y sección de comportamiento.
  • 00: 27: 18 - Efecto del extracto de brotes de brócoli en el autismo.
  • 00: 27: 48 - Efecto de la glucorafanina sobre la esquizofrenia.
  • 00: 28: 17 - Inicio de la discusión sobre la depresión (mecanismo plausible y estudios).
  • 00: 31: 21 - El estudio con ratones que utiliza los diferentes modelos de depresión inducida por estrés de 10 muestra que el sulforafano es igualmente eficaz que la fluoxetina (prozac).
  • 00: 32: 00 - El estudio muestra que la ingesta directa de glucorafanina en ratones es igualmente efectiva para prevenir la depresión por el modelo de estrés por derrota social.
  • 00: 33: 01 - Inicio de la sección de neurodegeneración.
  • 00: 33: 30 - Sulforafano y enfermedad de Alzheimer.
  • 00: 33: 44 - Sulforaphane y enfermedad de Parkinson.
  • 00: 33: 51 - Sulforaphane y la enfermedad de Hungtington.
  • 00: 34: 13 - Sulforaphane aumenta las proteínas de choque térmico.
  • 00: 34: 43 - Inicio de la sección de lesión cerebral traumática.
  • 00: 35: 01 - Sulforaphane inyectado inmediatamente después de un TBI mejora la memoria (estudio en ratones).
  • 00: 35: 55 - Sulforafano y plasticidad neuronal.
  • 00: 36: 32 - Sulforaphane mejora el aprendizaje en modelo de la diabetes tipo II en ratones.
  • 00: 37: 19 - Sulforaphane y duchenne distrofia muscular.
  • 00: 37: 44 - Inhibición de la miostatina en células satélite de músculo (in vitro).
  • 00: 38: 06 - Resumen de video tardío: mortalidad y cáncer, daño en el ADN, estrés oxidativo e inflamación, excreción de benceno, enfermedad cardiovascular, diabetes tipo II, efectos en el cerebro (depresión, autismo, esquizofrenia, neurodegeneración), vía NRF2.
  • 00: 40: 27 - Reflexiones sobre cómo calcular una dosis de brotes de brócoli o sulforafano.
  • 00: 41: 01 - Anécdotas sobre la brotación en el hogar.
  • 00: 43: 14 - En temperaturas de cocción y actividad de sulforafano.
  • 00: 43: 45 - Conversión de las bacterias intestinales del sulforafano a partir de glucorafanina.
  • 00: 44: 24 - Los suplementos funcionan mejor cuando se combinan con la mirosinasa activa de vegetales.
  • 00: 44: 56 - Técnicas de cocción y verduras crucíferas.
  • 00: 46: 06 - Isotiocianatos como goitrógenos.

Agradecimientos

Sciencedirect.com/science/article/pii/S2213231716302750

¿Cómo se produce el sulforafano?

El calentamiento disminuye la actividad de la proteína epitiospecificadora y aumenta la formación de sulforafano en el brócoli

Abstract

El sulforafano, un isotiocianato del brócoli, es uno de los anticarcinógenos derivados de los alimentos más potentes. Este compuesto no está presente en la verdura intacta, sino que se forma a partir de su precursor de glucosinolato, glucorafanina, por la acción de la mirosinasa, una enzima tioglucosidasa, cuando se tritura o se mastica el tejido de brócoli. Sin embargo, varios estudios han demostrado que el rendimiento de sulforafano a partir de la glucorafanina es bajo, y que un análogo de nitrilo no bioactivo, sulforafano nitrilo, es el producto primario de hidrólisis cuando el tejido de la planta se tritura a temperatura ambiente. La evidencia reciente sugiere que en Arabidopsis, la formación de nitrilo a partir de glucosinolatos está controlada por una proteína sensible al calor, epitiospecificador Proteína (ESP), un cofactor no catalítico de la mirosinasa. Nuestros objetivos fueron examinar los efectos del calentamiento de los brotes y brotes de brócoli en la formación de nitrilo de sulforafano y sulforafano, para determinar si el brócoli contiene actividad de ESP, y luego correlacionar los cambios dependientes del calor en la actividad de ESP, el contenido de sulforafano y la bioactividad, medida por inducción del Fase II, enzima de desintoxicación quinona reductasa (QR) en cultivo celular. El calentamiento de flósculos de brócoli frescos o brotes de brócoli a 60 ° C antes de la homogeneización aumentó simultáneamente la formación de sulforafano y disminuyó la formación de nitrilo de sulforafano. Una pérdida significativa de la actividad de ESP fue paralela a la disminución en la formación de nitrilo de sulforafano. El calentamiento a 70 ° C y más disminuyó la formación de ambos productos en flósculos de brócoli, pero no en brotes de brócoli. La inducción de QR en hepatoma de ratón cultivado Hepa lclc7 incrementó en paralelo los aumentos en la formación de sulforafano.

El precalentamiento de los brotes de brócoli y los brotes a 60 ° C aumentó significativamente la formación de sulforafano (SF) catalizada por la mirosinasa en extractos de tejidos vegetales después de la trituración. Esto se asoció con disminuciones en la formación de nitrilo de sulforafano (Nitrilo SF) y en la actividad de la proteína epitioespecificante (ESP).

Palabras clave: Brócoli, Brassica oleracea, Crucíferas, Cáncer, Anticarcinógeno, Sulforafano, Nilforforano, Nitrilo, Proteína Epitioespecífica, Quinona Reductasa

En conclusión, el sulforafano es un fitoquímico encontrado en brócoli,y otras hortalizas crucíferas. Una cantidad incontrolada de oxidantes causados ​​por factores internos y externos puede causar estrés oxidativo en el cuerpo humano que en última instancia puede conducir a una variedad de problemas de salud. El sulforafano puede activar la producción de Nrf2, un factor de transcripción que ayuda a regular los mecanismos antioxidantes protectores que controlan la respuesta de la célula a los oxidantes. El alcance de nuestra información se limita a problemas quiroprácticos y de salud espinal. Para discutir el tema, no dude en preguntar al Dr. Jiménez o comuníquese con nosotros al 915-850-0900 .

Comisariada por el Dr. Alex Jiménez

Remitido desde: Sciencedirect.com

Green Call Now Button H .png

Discusión del tema adicional: dolor de espalda agudo

El dolor de espalda es una de las causas más frecuentes de discapacidad y días perdidos en el trabajo en todo el mundo. El dolor de espalda se atribuye a la segunda razón más común para las visitas al consultorio del médico, superado en número solo por las infecciones de las vías respiratorias superiores. Aproximadamente el 80% de la población experimentará dolor de espalda al menos una vez a lo largo de su vida. La columna vertebral es una estructura compleja compuesta de huesos, articulaciones, ligamentos y músculos, entre otros tejidos blandos. Debido a esto, lesiones y / o condiciones agravadas, como hernias discales, eventualmente puede conducir a síntomas de dolor de espalda. Las lesiones deportivas o las lesiones por accidentes automovilísticos suelen ser la causa más frecuente de dolor de espalda; sin embargo, a veces los movimientos más simples pueden tener resultados dolorosos. Afortunadamente, las opciones de tratamiento alternativo, como la atención quiropráctica, pueden ayudar a aliviar el dolor de espalda mediante el uso de ajustes espinales y manipulaciones manuales, mejorando finalmente el alivio del dolor.

blog de imágenes de repartidor de periódicos de dibujos animados

EXTRA EXTRA | TEMA IMPORTANTE: El Paso, TX Quiropráctico

***